Skip to content

wysoka bilirubina leczenie

1 miesiąc ago

550 words

Badania immunoblottingu przeprowadzono co najmniej 3 razy. PCR na genomowym DNA. Genomowy DNA ekstrahowano z 5 x 105 komórek EndoC-aH2 i HEK 293T (CRL-11268, mykoplazm ujemny, ATCC) przy użyciu zestawu DNeasy Blood & Tissue Kit (QIAGEN). Zintegrowany SV40 LT poddano amplifikacji PCR za pomocą starterów RIP2 (sens: GTCCAATGAGCACTTTCT) i SV40 LT (antysensowny: GCAGACACTCTATGCCTGTGTGG) generujących produkty PCR o długości 892 bp. Zintegrowany hTERT zamplifikowano PCR z hTERT (sens: TTCCTACGCTTCATGTGCC) i 3. Startery LTR (antysensowne: CAGCTGCCTTGTAAGTC), generujące odpowiednio produkty PCR o 1030 bp. Izolacja RNA, odwrotna transkrypcja i RT-PCR. Całkowity RNA wyizolowano ze wszystkich różnych linii komórkowych przy użyciu zestawu QIAGEN RNeasy Mini Kit (QIAGEN), jak opisano wcześniej (10). Pierwszą nić cDNA przygotowano przy użyciu odczynników Superscript (Invitrogen), a RT-QPCR przeprowadzono stosując zestawy Assays na żądanie (Applied Biosystems), LightCycler 480 SYBR Green Master Mix (Roche) lub LightCycler 1536 DNA Green Master Mix (Roche) i analizowano na detektorze sekwencyjnym ABI Prism 7300 (Applied Biosystems) lub 1536 LightCycler (Roche) zgodnie z instrukcjami producenta. Wykaz sond i primerów TaqMan przedstawiono w Tabeli dodatkowej 2. Wydzielanie insuliny i zawartość insuliny. Komórki EndoC-aH2 wysiewano na 96-studzienkowe płytki powlekane Matrigelem i fibronektyną przy 3,5 x 104 komórek / studzienkę w przypadku komórek niewy- ważanych i 7 x 104 komórek / studzienkę w przypadku wyciętych komórek. Siedem dni później komórki inkubowano przez noc w pożywce hodowlanej, która zawierała 2,8 mM glukozy, a następnie w buforze Krebsa-Ringera buforowanym HEPES (KRB) (115 mmol / l NaCl, 5 mmol / l KCl, mmol / l CaCl2, mmol / l MgCl2, 24 mmol / l NaHCO3, 10 mmol / l HEPES, pH 7,4 i 0,2% BSA) zawierające 0,5 mM glukozy przez 60 minut. Pod koniec tej inkubacji stymulowane wydzielanie insuliny przez komórki mierzono przez statyczną inkubację w KRB, która zawierała zmienne stężenia glukozy przez 60 minut. Stymulacja glukozy została przeprowadzona w obecności lub nieobecności 500 .M IBMX (Sigma-Aldrich). W celu pomiaru zawartości insuliny komórki poddawano lizie bezpośrednio w dołkach hodowlanych za pomocą roztworu TETG przez 5 minut na lodzie. Roztwór do lizy TETG zawiera 20 mM Tris, pH 8,0, 0,1% Triton X-100, 1% glicerol, 137 mM NaCl, 2 mM EGTA i tabletkę anty-proteazową (Roche). Lizat następnie odwirowano przy 1700 g przez 5 minut w 4 ° C i przechowywano w. 20 ° C do testu ELISA na insulinę. Wydzielanie insuliny i wewnątrzkomórkową zawartość komórek EndoC-aH2 mierzono dwukrotnie w teście ELISA, zgodnie z instrukcjami producenta, stosując zestaw do ludzkiej insuliny (Mercodia), który wybrano ze względu na brak reaktywności krzyżowej z proinsuliną. Analiza transkryptomu. 25 ng całkowitego RNA amplifikowano za pomocą Aplauzu 3a-Amp System, a następnie znakowano biotyną przy użyciu modułu Encore Biotin zgodnie z instrukcjami producenta (NuGEN Technologies). Dystrybucja długości zamplifikowanych produktów cDNA została następnie oceniona przy użyciu Agilent 2100 Bioanalyzer (Agilent Technologies). Hybrydyzacje cDNA wyznakowanego biotyną do mikromacierzy Affymetrix HG-U133 Plus 2.0 GeneChip przeprowadzono w ATLAS Biolabs GmbH. Łącznie 3,75 .g cDNA na próbkę hybrydyzowano do genów Affymetrix HG-U133 Plus 2,0 GeneChips (Affymetrix) przez 16 do 18 godzin w 45 ° C i 60 rpm w obracającym się piecu do hybrydyzacji (Hybridization Oven 640, Affymetrix). Szereg został następnie przemyty i barwiony za pomocą stacji fluidyzacyjnej (GeneChip Fluidics Station 450, Affymetrix) zgodnie z protokołem EukGe_WSv4_450 dla fluidyzacji dla eukariotycznego 3. tablice ekspresyjne. Tablice skanowano przy użyciu GeneChip Scanner 3000 7G (Affymetrix). Podstawową analizę danych przeprowadzono przy użyciu oprogramowania GeneChip Operating System (GCOS) Affymetrix, v1.4. Tablica bazująca na oligonukleotydach (tablica CGH)
[podobne: mydocalm opinie, podgłośniowe zapalenie krtani, neosine syrop opinie ]

0 thoughts on “wysoka bilirubina leczenie”